Insertional Mutagenesis with Mos1 Transposon

Identification of mutated genes in forward genetics screens typically requires positional cloning, in which well-characterized genetic markers are used to map mutations to a specific region of the genome. However, transposon-mediated insertional mutagenesis offers an alternative for forward genetics screens. Mos1 is a well-characterized Drosophila transposon that can be utilized to induce mutations in nematodes. Primers specific for the unique sequence tag of Mos1 insertion alleles allow for amplication of the inserted region via PCR. Researchers have already used this method for rapid identification of mutated genes in C. elegans [1].

Here we describe Mos1 insertions that were characterized in C. briggsae by Marie-Anne Felix of the genetic map working group.

C. briggsae Mos Insertions
name	description	sequence
mf102	Mos1 insertion in intron of CBG23423	taatactgaatgtttctaacacgt
mf103	Mos1 insertion in intron of CBG113333 Ras-like protein	gacggtttgggagggctactatta
mf104	Mos1 insertion in CBG13195 Cb-dpy-18 in exon end	TATgtgagtcgatttgtttgatcgg

References

Williams DC, Boulin T, Ruaud AF, Jorgensen EM, Bessereau JL. 2005. Characterization of Mos1-mediated mutagenesis in Caenorhabditis elegans: a method for the rapid identification of mutated genes . Genetics. 2005 Mar;169(3):1779-85.